Review




Structured Review

Sangon Biotech primer premier 6.0
Primer Premier 6.0, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+6%2E0/primer+premier+5+0/pm40604479-56-7-13
Average 90 stars, based on 1 article reviews
primer premier 6.0 - by Bioz Stars, 2026-09
90/100 stars

Images

Related Articles

Polymerase Chain Reaction:

Article Title: DCLK1 mediated cooperative acceleration of EMT by avian leukosis virus subgroup J and Marek's disease virus via the Wnt/β-catenin pathway promotes tumor metastasis.
Article Snippet: Co-infection with oncogenic retrovirus and herpesvirus significantly facilitates tumor metastasis in human and animals.. Co-infection with avian leukosis virus subgroup J (ALV-J) and Marek’s disease virus (MDV), which are typical oncogenic retrovirus and herpesvirus, respectively, leads to enhanced oncogenicity and accelerated tumor formation, resulting in increased mortality of affected chickens.. Previously, we found that ALV-J and MDV cooperatively promoted tumor metastasis.

Article Title: Cost-effective duplex Kompetitive Allele Specific PCR markers for homologous genes facilitating wheat breeding
Article Snippet: Specific primers were artificially designed based on the differences, evaluated by Primer 6.0, and synthesized by Shanghai Sangon Biotech Co., Ltd. Standard FAM (5′GAAGGTGACCAAGTTCATGCT 3′) and HEX (5′ GAAGGTCGGAGTCAACGGATT 3′) tails were added to the front of the allele-specific primers F1 and F2, respectively.

Article Title: Metabolomic Profiles of Bovine Mammary Epithelial Cells Stimulated by Lipopolysaccharide
Article Snippet: Primers were designed with Primer 6.0 and synthesized by Shanghai Sangon Biological Engineering Technology & Services Co. Ltd (Shanghai, China).

Article Title: Polymorphisms in the DC-SIGN gene and their association with the severity of hand, foot, and mouth disease caused by enterovirus 71.
Article Snippet: Severe hand, foot, and mouth disease (HFMD) caused by enterovirus 71 (EV71) infection is associated with high mortality and disability.. DC-SIGN, a receptor for EV71, is widely distributed in dendritic cells and may influence the severity of HFMD caused by EV71 infection.. This observational study attempts to explore whether single-nucleotide polymorphisms (SNPs) in DC-SIGN are related to the severity of EV71-associated HFMD.

Article Title: Molecular evolutionary analysis of the high-affinity K+ transporter gene family in angiosperms.
Article Snippet: All primers were designed using PRIMER 6.0 (http://www.PremierBiosoft.com) and were synthesized by Sangon Biotech, Shanghai, China.

Article Title: Linkage and association mapping and Kompetitive allele-specific PCR marker development for improving grain protein content in wheat.
Article Snippet: Key Message Linkage and association mapping identified nine candidate intervals for wheat GPC, and large-scale association mapping based on 9 corresponding KASP markers and 1163 F4 breeding lines revealed 3 significant markers.. Abstract Wheat grain protein content (GPC) is an important quality indicator.. The GPC of wheat grown in the middle and lower reaches of the Yangtze River is often low.

Software:

Article Title: DCLK1 mediated cooperative acceleration of EMT by avian leukosis virus subgroup J and Marek's disease virus via the Wnt/β-catenin pathway promotes tumor metastasis.
Article Snippet: Co-infection with oncogenic retrovirus and herpesvirus significantly facilitates tumor metastasis in human and animals.. Co-infection with avian leukosis virus subgroup J (ALV-J) and Marek’s disease virus (MDV), which are typical oncogenic retrovirus and herpesvirus, respectively, leads to enhanced oncogenicity and accelerated tumor formation, resulting in increased mortality of affected chickens.. Previously, we found that ALV-J and MDV cooperatively promoted tumor metastasis.

Article Title: Cost-effective duplex Kompetitive Allele Specific PCR markers for homologous genes facilitating wheat breeding
Article Snippet: Specific primers were artificially designed based on the differences, evaluated by Primer 6.0, and synthesized by Shanghai Sangon Biotech Co., Ltd. Standard FAM (5′GAAGGTGACCAAGTTCATGCT 3′) and HEX (5′ GAAGGTCGGAGTCAACGGATT 3′) tails were added to the front of the allele-specific primers F1 and F2, respectively.

Article Title: Metabolomic Profiles of Bovine Mammary Epithelial Cells Stimulated by Lipopolysaccharide
Article Snippet: Primers were designed with Primer 6.0 and synthesized by Shanghai Sangon Biological Engineering Technology & Services Co. Ltd (Shanghai, China).

Article Title: Polymorphisms in the DC-SIGN gene and their association with the severity of hand, foot, and mouth disease caused by enterovirus 71.
Article Snippet: Severe hand, foot, and mouth disease (HFMD) caused by enterovirus 71 (EV71) infection is associated with high mortality and disability.. DC-SIGN, a receptor for EV71, is widely distributed in dendritic cells and may influence the severity of HFMD caused by EV71 infection.. This observational study attempts to explore whether single-nucleotide polymorphisms (SNPs) in DC-SIGN are related to the severity of EV71-associated HFMD.

Article Title: Molecular evolutionary analysis of the high-affinity K+ transporter gene family in angiosperms.
Article Snippet: All primers were designed using PRIMER 6.0 (http://www.PremierBiosoft.com) and were synthesized by Sangon Biotech, Shanghai, China.

Article Title: Linkage and association mapping and Kompetitive allele-specific PCR marker development for improving grain protein content in wheat.
Article Snippet: Key Message Linkage and association mapping identified nine candidate intervals for wheat GPC, and large-scale association mapping based on 9 corresponding KASP markers and 1163 F4 breeding lines revealed 3 significant markers.. Abstract Wheat grain protein content (GPC) is an important quality indicator.. The GPC of wheat grown in the middle and lower reaches of the Yangtze River is often low.

Synthesized:

Article Title: DCLK1 mediated cooperative acceleration of EMT by avian leukosis virus subgroup J and Marek's disease virus via the Wnt/β-catenin pathway promotes tumor metastasis.
Article Snippet: Co-infection with oncogenic retrovirus and herpesvirus significantly facilitates tumor metastasis in human and animals.. Co-infection with avian leukosis virus subgroup J (ALV-J) and Marek’s disease virus (MDV), which are typical oncogenic retrovirus and herpesvirus, respectively, leads to enhanced oncogenicity and accelerated tumor formation, resulting in increased mortality of affected chickens.. Previously, we found that ALV-J and MDV cooperatively promoted tumor metastasis.

Article Title: Cost-effective duplex Kompetitive Allele Specific PCR markers for homologous genes facilitating wheat breeding
Article Snippet: Specific primers were artificially designed based on the differences, evaluated by Primer 6.0, and synthesized by Shanghai Sangon Biotech Co., Ltd. Standard FAM (5′GAAGGTGACCAAGTTCATGCT 3′) and HEX (5′ GAAGGTCGGAGTCAACGGATT 3′) tails were added to the front of the allele-specific primers F1 and F2, respectively.

Article Title: Metabolomic Profiles of Bovine Mammary Epithelial Cells Stimulated by Lipopolysaccharide
Article Snippet: Primers were designed with Primer 6.0 and synthesized by Shanghai Sangon Biological Engineering Technology & Services Co. Ltd (Shanghai, China).

Article Title: Polymorphisms in the DC-SIGN gene and their association with the severity of hand, foot, and mouth disease caused by enterovirus 71.
Article Snippet: Severe hand, foot, and mouth disease (HFMD) caused by enterovirus 71 (EV71) infection is associated with high mortality and disability.. DC-SIGN, a receptor for EV71, is widely distributed in dendritic cells and may influence the severity of HFMD caused by EV71 infection.. This observational study attempts to explore whether single-nucleotide polymorphisms (SNPs) in DC-SIGN are related to the severity of EV71-associated HFMD.

Article Title: Molecular evolutionary analysis of the high-affinity K+ transporter gene family in angiosperms.
Article Snippet: All primers were designed using PRIMER 6.0 (http://www.PremierBiosoft.com) and were synthesized by Sangon Biotech, Shanghai, China.

Article Title: Linkage and association mapping and Kompetitive allele-specific PCR marker development for improving grain protein content in wheat.
Article Snippet: Key Message Linkage and association mapping identified nine candidate intervals for wheat GPC, and large-scale association mapping based on 9 corresponding KASP markers and 1163 F4 breeding lines revealed 3 significant markers.. Abstract Wheat grain protein content (GPC) is an important quality indicator.. The GPC of wheat grown in the middle and lower reaches of the Yangtze River is often low.



Similar Products

90
Premier Biosoft primer premier 6.0
Primer Premier 6.0, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+6%2E0/primer+premier+5+0/pmc12166874-52-9-12
Average 90 stars, based on 1 article reviews
primer premier 6.0 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
PrimerDesign Inc primer design software primer 6.0
Primer Design Software Primer 6.0, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+6%2E0/primer+design+software+primer+6+0/pmc12203461-122-13-10
Average 90 stars, based on 1 article reviews
primer design software primer 6.0 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Unigene primer 6.0 software
Primer 6.0 Software, supplied by Unigene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+6%2E0/primer+5+0+software/pmc12270148-167-0-16
Average 90 stars, based on 1 article reviews
primer 6.0 software - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Sangon Biotech primer premier 6.0
Primer Premier 6.0, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+6%2E0/primer+premier+5+0/pm40604479-56-7-13
Average 90 stars, based on 1 article reviews
primer premier 6.0 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
PrimerDesign Inc primer 6.0
Primer 6.0, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+6%2E0/primer+6+0/pm40610450-262-5-0
Average 90 stars, based on 1 article reviews
primer 6.0 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Sangon Biotech primer premier 6.0 software
Primer Premier 6.0 Software, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+6%2E0/primer+premier+5+0+software/pm40646825-79-10-17
Average 90 stars, based on 1 article reviews
primer premier 6.0 software - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Premier Biosoft primer premier 6.0 software
Primer Premier 6.0 Software, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+6%2E0/primer+premier+5+0+software/pmc12183340-107-8-12
Average 90 stars, based on 1 article reviews
primer premier 6.0 software - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Premier Biosoft primers designed using primer premier 6.0
Primers Designed Using Primer Premier 6.0, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+6%2E0/primers+designed+using+primer+premier+5+0/pmc12186849-91-0-7
Average 90 stars, based on 1 article reviews
primers designed using primer premier 6.0 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Gallus BioPharmaceuticals primer 6.0 software
Primer 6.0 Software, supplied by Gallus BioPharmaceuticals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+6%2E0/primer+6+0+software/pmc12150608-121-4-14
Average 90 stars, based on 1 article reviews
primer 6.0 software - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results